Journal: FEBS letters

Article Title: Differential effects of the N-terminal helix of FGF8b on the activity of a small-molecule FGFR inhibitor in cell culture and for the extracellular domain of FGFR3c in solution.

doi: 10.1002/1873-3468.14976

Figure Lengend Snippet: Fig. 1. Activity of SSR against FGF2 and FGF8b. (A–D) Fluorescence intensity analysis of U-2 OS cells immunolabeled for pMAPK (pY202/ 204) (A, B) or pPLCγ1 (pY783) (C, D) after stimulation with FGF2 (A, C) and FGF8b (B, D) and in the presence and absence of 25 μM SSR. The statistical significance was evaluated using the Mann–Whitney U test (*P < 0.05; **P < 0.01; ***P < 0.001; n.s., non-significant). Number of biologically independent replicates is n = 4 for A, B, and D; and 3 for panel C. (E) Representative microscopic images of proliferating bEnd.3 cells (EdU+, green; upper panel) and total bEnd.3 cells (nuclear marker DAPI, gray; bottom panel). Length of the scale bar equals 100 μM. (F) Percentage of proliferating human bEnd.3 cells upon stimulation by FGF2 and FGF8b in the presence and absence of either 50 nM or 100 μM SSR. BSA was used as a negative control. Error bars represent the SEM. Number of biologically independent replicates is n = 3.

Article Snippet: The human osteosarcoma cell line U-2 OS (CLS Cell Lines Service GmbH, Eppelheim, Germany; cat. no. 300364) was grown in growth medium consisting of high glucose DMEM/F-12 (Gibco, Grand Island, NY, USA; cat. no. 21041025) and supplemented with 1% GlutaMAX (Gibco; cat. no. 35050061), 1 unit mL 1 penicillin, 1 μg mL 1 streptomycin (Gibco; cat. no. 10378016), and 10% FBS (Satorius, Goettingen, Germany) at 37 °C and 5% CO2.

Techniques: Activity Assay, Fluorescence, Immunolabeling, MANN-WHITNEY, Marker, Negative Control

Journal: Nature methods

Article Title: Deep learning enables fast and dense single-molecule localization with high accuracy

doi: 10.1038/s41592-021-01236-x

Figure Lengend Snippet: a) DECODE can reduce acquisition times by one order of magnitude. The same sample of microtubules, labeled with anti-α-tubulin primary and AF647 secondary antibodies, imaged with different UV activation intensities to result in different emitter densities per frame, between 0.08 and 0.86μm −2 and acquisition times between 93 and 1120 s, while keeping the total number of localizations the same. For high-density activation, we show a comparison with CSpline. b) Fourier Ring Correlation curves for DECODE and CSpline for different emitter densities. c) Resolution estimates obtained using the Fourier Ring Correlation and 0.143 criterion across densities for both methods. d) Fast live-cell SMLM on the Golgi apparatus labeled with a -mannosidase II-mEos3.2. See Supplementary Movie 1. e) Fast live-cell SMLM on the endoplasmic reticulum labeled with calnexin-mEos3.2. See Supplementary Movie 2 and . f) Fast live-cell SMLM on the nuclear pore complex protein Nup96-mMaple acquired in 3 seconds. g) DECODE enables ultra-high labeling densities. Microtubules labeled with a high concentration of anti-α and anti-β-tubulin primary and Alexa Fluor 647 secondary antibodies. g1, g2) Magnified regions as indicated in g. Data acquired with high-density labeling shows continuous structures. As a comparison, the same sample was acquired after pre-bleaching of the fluorophores to reach the single-molecule blinking regime. Here, single labels are resolved in the superresolution reconstruction and lead to a sparse decoration of the microtubules. g3, g4) Side view reconstructions of regions as indicated in g1, g2 resolving the hollow, cylinder-like structure of immunolabeled microtubules. h) Representative raw camera frames for the high-density and single-emitter acquisitions, respectively. Scale bars: 10μm (f inset, h), 1 μm (a, d, e, f, g, g1, g2), 100nm (g3, g4).

Article Snippet: The pulse length of the 405nm laser was adjusted manually to maintain a high emitter density and to allow imaging of all fluorophores in the field of view in about 1 min. For the acquisition of live-cell data of Nup96-mMaple , coverslips containing Nup96-mMaple cells (catalog no. 300461; CLS Cell Line Service, Eppelheim, Germany) were rinsed twice with warm PBS before they were mounted in 1mL growth medium containing 20 mM HEPES buffer and imaged directly.

Techniques: Labeling, Activation Assay, Comparison, Concentration Assay, Immunolabeling

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 1 The nuclear membrane is preserved during NE preparation. (A) Schematics of the human nuclear pore complex, with emphasis on basket organization. (B) Schematic procedure for nuclear envelope preparation from cultured U2OS. (C) 3D-confocal imaging of nuclei isolated from U2OS and treated or not with nucleases. The chromatin was labeled with Hoechst (blue) and NPCs with WGA (white). Top panels show xz sections; bottom panels show the lower nuclear membrane. Scale bar is 5 µm. (D) Confocal imaging of an open nucleus. NPCs are labeled with WGA-AF594, lipids with DiOC6. Scale bar is 5 µm. The right panel shows the intensity profile of the lipid dye along the cyan section. (E) Nuclei and nuclear envel- opes were extracted from U2OS/Nup96-SNAP. Intact cells, intact nuclei or open nuclei were labelled with mAb414-AF594 and AF647-SNAP ligand. Diffraction-limited (mAb414) and dSTORM images (Nup96-SNAP) were acquired in TIRF illumination; scale bars are 2 µm (top) and 500 nm (bottom). (F) Pore density was measured from confocal images (shown in Fig. S2C,† n > 20 nuclei); NPC radii were measured from dSTORM images as exem- plified in E ( n ≥3 nuclei).

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Membrane, Cell Culture, Imaging, Isolation, Labeling

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 2 Structure of the NPC basket. (A) Correlative fluorescence/AFM image of an open nucleus isolated from U2OS overexpressing POM121-GFP. Left: TIRF image of the entire nucleus overlaid with the region scanned by AFM. Right: Height image acquired by AFM, encompassing the opening border. Scale bars are 5 µm (left), 2 µm (right). (B) Correlative TIRF/AFM image of the inner nuclear envelope of an open nucleus. NPCs are labelled with mAb414 and visualized as fluorescent dots that coincide with ring-like structures in the AFM image. Scale bars are 2 µm and 200 nm. (C) Representative samples of human nuclear pores (nucleoplasmic face) imaged by AFM. Scale bar is 100 nm. (D) Three configurations of NPC nucleo- plasmic region and their respective height profile. “Empty” (blue), protruding (orange) and low basket (green). (E) Mean of rotationally averaged NPC height profiles (n = 210). The shaded area represents the standard deviation. (F) (Left) Average image of 210 NPC crops. AFM color scale as above. (Right) Height profile of the resulting image. (G and H) Diameter and depths distributions of 210 NPCs plotted as frequencies and fitted with one (respectively two) Gaussians. The dashed line represents the fit function. These graphs are also shown in Fig. S2D & E† to illustrate the analysis workflow.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Isolation, Standard Deviation

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 3 Tpr organization within the NPC basket. (A) Correlative AFM/dSTORM image of an open nucleus prepared from U2OS cells. The sample was immuno-labelled against Tpr. dSTORM imaging was performed in TIRF illumination. The same area was then imaged by AFM. After reconstruction of the dSTORM localizations map, the two images were correlated (scale bar is 200 nm). AFM color scale 0–300 nm. (B) 3D representation of the cor- related AFM/dSTORM image. (C) Three NPCs of typically different topographies are shown in more details, together with their rotationally averaged height profiles (upper panel). Arrows point at Tpr localizations (scale bar is 100 nm). AFM color scale 0–300 nm. (D) U2OS cells were fixed and simul- taneously immuno-labelled against Nup153, Tpr or Elys, with a secondary antibody coupled to STAR-635P (green) and Nup153 coupled to AlexaFluor 594 (red). Samples were imaged by STED microscopy. Individual NPCs are zoomed on the right (scale bars are 1 µm and 100 nm). (E) Distance distribution between the AlexaFluor 594 and STAR-635P signals measured from STED images (number of pores >2700).

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Imaging, Microscopy

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 4 Basket contribution in the topography of human NPCs. (A) Stable U2OS cells expressing Nup96-GFP were transfected with siRNAs, scrambled or targeted against Nup153. Cells were then fixed, co-labeled with anti-Nup153 (red) and anti-Tpr (blue) and imaged by confocal microscopy. Arrows indicate pores depleted of Nup153. They are consistently co-depleted of Tpr (scale bar is 1 µm). (B) Correlative AFM-fluor- escence image of a NE prepared from U2OS/Nup96-GFP cells depleted of Nup153 by siRNA and labeled with anti-Nup153. Panel d shows the ROI scanned by AFM. Top panels show the corresponding Nup96 (b) and Nup153 (c) channels imaged by TIRF. In panels b–d, NPCs are circled in white when Nup153 is detected and in red when it is absent or weak. Scale bars are respectively 500 nm (a–c) and 200 nm (d). (C) Rotationally averaged height profiles were averaged from over 80 pores imaged from control (black) and siNup153-treated cells (red). Shaded areas are standard devi- ations. (D) The average contribution of the basket in the NPC structure can be envisioned as the volume located between the average surface of control NPCs and of basket-depleted NPCs. A cross-section of this volume is represented as the grey shaded area.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Expressing, Transfection, Labeling, Confocal Microscopy, Control

Journal: Nanoscale

Article Title: Structure and mechanics of the human nuclear pore complex basket using correlative AFM-fluorescence superresolution microscopy.

doi: 10.1039/d2nr06034e

Figure Lengend Snippet: Fig. 5 Mechanical properties of the NPC basket. (A) AFM height and stiffness images of NPCs. Scale bar is 100 nm. (B) Height and stiffness profiles measured from single pores (along the line depicted on the left panels). The light grey bars indicate the location of the scaffold’s ring. (C) Mean of rotationally averaged height (blue) and stiffness (red, dashed) profiles obtained from over 80 individual NPCs. (D) Mean of rotationally averaged stiffnesses of NPCs from nuclear envelopes pre- pared from control (blue profile) or Nup153-depleted (red) U2OS cells. Standard deviations are represented as shaded areas.

Article Snippet: CRISPR-engineered Nup96-SNAP U2OS cell lines48 were obtained from CLS (clsgmbh.de). siRNAs were ordered from Eurogentec: siNup153 according to the sequence in ref. 77 (AAGGCAGACUCUACCAAAUGUUU dTdT) and scrambled siRNA (UAGAUACCAUGCACAAAUCC dTdT).

Techniques: Control

Journal: Cells

Article Title: Ischemic Stroke Risk Associated with Mitochondrial Haplogroup F in the Asian Population

doi: 10.3390/cells9081885

Figure Lengend Snippet: HIF-1α expressions in different cybrids under hypoxia-ischemia. Comparison of HIF-1α expression under hypoxic-ischemic conditions in cybrids harboring common mitochondrial haplogroups found in the ethnic Chinese population (B4, B5, D4, D5, F1, F2, N9). The 143B cybrid was used to represent the Caucasian population. Actin was used as a loading control. Data represent the mean ± SD of at least three independent experiments ( # p < 0.005). N was used to represent normoxic and H to represent the hypoxic condition for 24 h.

Article Snippet: MtDNA-depleted ρ0 cells were established by the treatment of human osteosarcoma 143B cells (BCRC 60439) (Bioresource Collection and Research Center, Taipei, Taiwan) with ethidium bromide for three months, and illustration of their mtDNA-less cellular status by RT-PCR has been previously described [ , ].

Techniques: Comparison, Expressing, Control

Journal: Biomedicines

Article Title: Anti-Inflammatory and Cancer-Preventive Potential of Chamomile ( Matricaria chamomilla L.): A Comprehensive In Silico and In Vitro Study

doi: 10.3390/biomedicines12071484

Figure Lengend Snippet: Confocal immunofluorescence microscopy of the microtubule network in U2OS cells upon treatment with ( A ) quercetin and ( B ) lupeol at concentrations of 0.1 µM, 1 µM, and 10 µM for 24 h. Vincristine (1 µM) and paclitaxel (1 µM) served as positive controls and DMSO as the negative control. The cells were imaged using a Thunder Imager Live Cell microscope with a 63×/1.40 NA objective lens (HC PL APO CS2 63×/1.40 OIL UV). The microtubules were visualized using green fluorescence for GFP (green), and the images were merged with DAPI (blue) to highlight the nucleus.

Article Snippet: In this context, it was interesting that the cytotoxicity of both compounds in CCRF-CEM and U2OS cells was not caused by apoptosis as the most common mode of cell death but by necrosis.

Techniques: Immunofluorescence, Microscopy, Negative Control, Fluorescence

Journal: Biomedicines

Article Title: Anti-Inflammatory and Cancer-Preventive Potential of Chamomile ( Matricaria chamomilla L.): A Comprehensive In Silico and In Vitro Study

doi: 10.3390/biomedicines12071484

Figure Lengend Snippet: Cell cycle arrest of U2OS cells by quercetin and lupeol. ( A ) Debris was gated out (SSC-A vs. FSC-A) with the first gate. ( B ) With the second gate (FSC-H vs. FSC-A), only single cells of normal morphology were gated. Duplets were gated out. ( C , D ) Three-dimensional representation of DNA histograms of U2OS cells exposed to 1 × IC 50 and 4 × IC 50 quercetin and lupeol for 72 h. DMSO was used as the negative control, and 1 × IC 50 vincristine was used as the positive control. ( C ) Cells treated with lupeol and ( D ) cells treated with quercetin. The histograms were obtained through flow cytometry using an excitation of 488 nm and an emission wavelength of 530 nm. ( E , F ) Bar diagrams showing the distinct phases of cell cycle upon treatment with quercetin and lupeol for 72 h. ( E ) Cells treated with lupeol and ( F ) cells treated with quercetin. The bar diagrams were created through the calculation of the mean values ± SD of three independent experiments. *** p < 0.001, ** p < 0.01, and * p < 0.05 compared to the negative control using paired two-tailed t -test.

Article Snippet: In this context, it was interesting that the cytotoxicity of both compounds in CCRF-CEM and U2OS cells was not caused by apoptosis as the most common mode of cell death but by necrosis.

Techniques: Negative Control, Positive Control, Flow Cytometry, Two Tailed Test

Journal: Biomedicines

Article Title: Anti-Inflammatory and Cancer-Preventive Potential of Chamomile ( Matricaria chamomilla L.): A Comprehensive In Silico and In Vitro Study

doi: 10.3390/biomedicines12071484

Figure Lengend Snippet: Dose–response curves of quercetin and lupeol as determined through resazurin assay. The mean values and standard deviation values are from three independent experiments. The tumor cells were subjected to treatment with each compound at concentrations of 10 µM, 25 µM, 50 µM, and 100 µM for 72 h. ( A ) Sensitive CCRF-CEM and the drug-resistant P-glycoprotein overexpressing CEM/ADR5000 leukemia cells. ( B ) U87/ΔEGFR transfected with a deletion-activated cDNA of EGFR and its wild-type U87MG glioblastoma cells. ( C ) HCT116 p53 +/+ and knockout HCT116 p53 −/− colorectal cancer cells. ( D ) U2OS osteosarcoma cells.

Article Snippet: In this context, it was interesting that the cytotoxicity of both compounds in CCRF-CEM and U2OS cells was not caused by apoptosis as the most common mode of cell death but by necrosis.

Techniques: Resazurin Assay, Standard Deviation, Transfection, Knock-Out

Journal: Biomedicines

Article Title: Anti-Inflammatory and Cancer-Preventive Potential of Chamomile ( Matricaria chamomilla L.): A Comprehensive In Silico and In Vitro Study

doi: 10.3390/biomedicines12071484

Figure Lengend Snippet: Detection of cell death in U2OS cells using flow cytometry and annexin-V/PI staining using a flow cytometer. ( A , B ) Cells treated for 72 h with 0.5 × IC 50 , 1 × IC 50 , 2 × IC 50 , and 4 × IC 50 of lupeol and quercetin, respectively. ( C , D ) represent bar diagrams of the percentage of cells in quadrium treated with lupeol ( C ) and quercetin ( D ). For details, see . Treatment with both compounds at 4 × IC 50 showed a tendency for increased necrosis, which was, however, not statistically significant compared to the negative control.

Article Snippet: In this context, it was interesting that the cytotoxicity of both compounds in CCRF-CEM and U2OS cells was not caused by apoptosis as the most common mode of cell death but by necrosis.

Techniques: Flow Cytometry, Staining, Negative Control

Journal: Acta Biotheoretica

Article Title: Tumor Growth, Proliferation and Diffusion in Osteosarcoma

doi: 10.1007/s10441-025-09494-4

Figure Lengend Snippet: Approximation of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha$$\end{document} α and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta$$\end{document} β parameters for power law

Article Snippet: The U2OS cell line, established by Pontén and Saksela in 1964 (Pontén and Saksela ), from a moderately differentiated sarcoma of the tibia in a 15-year-old girl (Merck KGaA (Merck)), represents one of the first human cell lines derived from a mesenchymal tumor.

Techniques:

Journal: Acta Biotheoretica

Article Title: Tumor Growth, Proliferation and Diffusion in Osteosarcoma

doi: 10.1007/s10441-025-09494-4

Figure Lengend Snippet: Approximation of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\rho$$\end{document} ρ parameters with logistic model

Article Snippet: The U2OS cell line, established by Pontén and Saksela in 1964 (Pontén and Saksela ), from a moderately differentiated sarcoma of the tibia in a 15-year-old girl (Merck KGaA (Merck)), represents one of the first human cell lines derived from a mesenchymal tumor.

Techniques:

Journal: Acta Biotheoretica

Article Title: Tumor Growth, Proliferation and Diffusion in Osteosarcoma

doi: 10.1007/s10441-025-09494-4

Figure Lengend Snippet: Summary of results \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha$$\end{document} α , \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta$$\end{document} β , \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\rho$$\end{document} ρ , and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\bar{D}$$\end{document} D ¯ vs. experimental data

Article Snippet: The U2OS cell line, established by Pontén and Saksela in 1964 (Pontén and Saksela ), from a moderately differentiated sarcoma of the tibia in a 15-year-old girl (Merck KGaA (Merck)), represents one of the first human cell lines derived from a mesenchymal tumor.

Techniques: